Which of the following is an example of complementary base pairing?
A. guanine—uracil
B. adenine—cytosine
C. cytosine—thymine
D. cytosine—guanine
What structure prevents food from entering the trachea?
A. the tongue
B. the pharynx
C. the epiglottis
D. the cardiac sphincter
Which is a function of the large intestine?
A. the secretion of bile
B. the absorption of vitamins
C. the production of glycogen
D. the release of sodium bicarbonate
Which enzyme functions optimally in a low pH?
A. lipase
B. pepsin
C. trypsin
D. amylase
The removal of the gall bladder would affect the rate of digestion of which of the following?
A. lipids
B. proteins
C. nucleotides
D. carbohydrates
Cilia in the trachea sweep debris toward which of the following structures?
A. the alveoli
B. the bronchi
C. the pharynx
D. the bronchioles
Urine enters the bladder through which structure?
A. the ureter
B. the kidney
C. the urethra
D. the collecting duct
What structure secretes aldosterone?
A. the adrenal gland
B. the hypothalamus
C. the pituitary gland
D. the medulla oblongata
Which of the following structures secretes testosterone?
A. the prostate
B. the epididymis
C. the vas deferens
D. the interstitial cells
What type of molecule is adenosine triphosphate (ATP)?
A. a fat
B. a steroid
C. a protein
D. a nucleotide
Where is blood velocity the slowest?
A. in a vein
B. in a venule
C. in an artery
D. in a capillary
What part of the brain controls the release of hormones from the pituitary gland?
A. the thalamus
B. the cerebrum
C. the hypothalamus
D. the corpus callosum
During which process would adenine bond with thymine but not uracil?
A. translation
B. replication
C. transcription
D. dehydration synthesis
Consider the following portion of an mRNA strand:
UAC GGG AUA
What are the anticodons that will be paired to this strand?
A. AT G CCC TAT
B. AT A GGG TAC
C. AUG CCC UAU
D. UAC GGG AUA
What is the function of thyroxin?
A. to cause ovulation
B. to increase metabolic rate
C. to decrease the rate of digestion
D. to control the concentration of sodium ions in the blood
What two structures produce chemicals that digest proteins?
A. the liver and the pancreas
B. the salivary and intestinal glands
C. the gastric glands and the pancreas
D. the gastric glands and the gall bladder
3. Using the genetic code table, complete the following: (3 pts)
Genetic code (DNA code) of a gene is: ATGCCGTTGATTACTCAAGCCTGA
a) What will be the sequence of the mRNA? __________________________________________________  _____

 What will be the amino acid sequence of a protein produced from this? __________________________________________________  ____________
c) Due to mutation, the above genetic code has been changed to: ATGCCCGTTGATTACTCAAGCCTTG. What kind of mutation is this called?